Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))

Ronan C. O'Malley, Shao shan Carol Huang, Liang Song, Mathew G. Lewsey, Anna Bartlett, Joseph R. Nery, Mary Galli, Andrea Gallavotti, Joseph R. Ecker

Research output: Contribution to journalComment/debatepeer-review

Abstract

(Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused.

Original languageEnglish (US)
Pages (from-to)1598
Number of pages1
JournalCell
Volume166
Issue number6
DOIs
StatePublished - Sep 8 2016

ASJC Scopus subject areas

  • Biochemistry, Genetics and Molecular Biology(all)

Fingerprint Dive into the research topics of 'Erratum: Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape (Cell (2016) 165(5) (1280–1292))'. Together they form a unique fingerprint.

Cite this